eagle-i Oregon Health & Science UniversityOregon Health & Science University
See it in Search
This page is a preview of the following resource. Continue onto eagle-i search using the button on the right to see the full record.

pcDNA-Zeo-Fxna-FLAG plasmid

eagle-i ID

http://ohsu.eagle-i.net/i/0000013f-777e-fadb-f351-2c0e80000000

Resource Type

  1. Plasmid

Properties

  1. Construct Insert
    Fxna
  2. Resource Description
    "A tagged Fxna construct was generated by PCR-amplifying the Fxna coding region from ovarian RNA with a sense primer (5􏰂- GGATCCGCTGCCGCCATGGAGTGG-3􏰂) and an antisense primer (5􏰂- GATATCATATTACTTGTCGTCATCGTCTTTGTAGTCA A ACACA A AGA- GACTATA-3􏰂) that contains a FLAG epitope-coding sequence (in italics); BamH1 and EcoRV sequences added to the sense and antisense primers, respectively, are underlined. The resulting construct was ligated into pcDNA-Zeo (Invitrogen)."
  3. Construct Backbone
    pcDNA-Zeo
  4. Related Publication or Documentation
    Fxna, a novel gene differentially expressed in the rat ovary at the time of folliculogenesis, is required for normal ovarian histogenesis
  5. Location
    Sergio Ojeda Laboratory
 
RDFRDF
 
Provenance Metadata About This Resource Record

Copyright © 2016 by the President and Fellows of Harvard College
The eagle-i Consortium is supported by NIH Grant #5U24RR029825-02 / Copyright 2016