This page is a preview of the following resource. Continue onto eagle-i search using the button on the right to see the full record.

pcDNA-Zeo-Fxna-FLAG plasmid

http://ohsu.eagle-i.net/i/0000013f-777e-fadb-f351-2c0e80000000

Construct Insert

Fxna
Resource Description

"A tagged Fxna construct was generated by PCR-amplifying the Fxna coding region from ovarian RNA with a sense primer (5􏰂- GGATCCGCTGCCGCCATGGAGTGG-3􏰂) and an antisense primer (5􏰂- GATATCATATTACTTGTCGTCATCGTCTTTGTAGTCA A ACACA A AGA- GACTATA-3􏰂) that contains a FLAG epitope-coding sequence (in italics); BamH1 and EcoRV sequences added to the sense and antisense primers, respectively, are underlined. The resulting construct was ligated into pcDNA-Zeo (Invitrogen)."
Construct Backbone

pcDNA-Zeo
Related Publication or Documentation

Fxna, a novel gene differentially expressed in the rat ovary at the time of folliculogenesis, is required for normal ovarian histogenesis
Location

Sergio Ojeda Laboratory

Inferred Types from the eagle-i Ontology (What is an ontology?)

Provenance Metadata About This Resource Record