eagle-i Oregon Health & Science UniversityOregon Health & Science University
See it in Search
This page is a preview of the following resource. Continue onto eagle-i search using the button on the right to see the full record.

Rat Eed cRNA probe

eagle-i ID

http://ohsu.eagle-i.net/i/0000013f-77c0-5c36-f351-2c0e80000000

Resource Type

  1. RNA probe

Properties

  1. Entrez Gene ID
    http://www.ncbi.nlm.nih.gov/gene/293104
  2. Related Publication or Documentation
    Epigenetic control of female puberty.
  3. Related Technique
    In situ hybridization
  4. Entrez Gene Symbol
    Eed
  5. Source Organism or Virus
    Rattus_norvegicus
  6. Sequence
    Primer: rEed-f; ATGTCTGAGAGGGAAGTGTCGACTGCG
  7. Sequence
    Primer: rEed-r; GCTGGTGTTGCTATCATAGGTCCA
  8. Location
    Sergio Ojeda Laboratory
 
RDFRDF
 
Provenance Metadata About This Resource Record

Copyright © 2016 by the President and Fellows of Harvard College
The eagle-i Consortium is supported by NIH Grant #5U24RR029825-02 / Copyright 2016