eagle-i Oregon Health and Science UniversityOregon Health and Science University
See it in Search

Sergio Ojeda Laboratory

Summary:

Sergio Ojeda and his collaborators seek to understand the process by which the brain controls the initiation of mammalian puberty. An important goal in their laboratory is to gain insights into the molecular and genetic mechanisms underlying deranged sexual development, particularly sexual precocity and delayed puberty of cerebral origin. Ojeda's team focuses on identifying molecules responsible for the interactions that occur between neurons and glial cells in the hypothalamus, a region in the base of the brain that controls several bodily functions, including hormone secretion, reproduction, response to stress, feeding and sex behavior. One group of hypothalamic neurons produces gonadotropin-releasing hormone (GnRH), a substance that controls the secretion of reproductive hormones from the pituitary gland.

The investigators are using cellular, molecular, genetics and systems biology strategies, in addition to high-throughput approaches and computational biology methods to develop three interrelated concepts: 1) That mammalian puberty is controlled by genetic networks that, operating within different cell contexts in the neuroendocrine brain, coordinate the activity of GnRH neurons at puberty, 2) That these networks are controlled at the transcriptional level by a repressive mechanism exerted by discrete subsets of gene "silencers", and 3) That this transcriptional regulation is under epigenetic control, i.e. a mechanism by which environmental factors (such as nutrition, man-made chemicals, changes in light/dark cycle, etc.) regulate gene activity without modifying the actual sequence of encoding DNA.

Affiliations:

People:

Resources:

Organisms and Viruses

  • EAP1-1hp siRNA lentivirus ( transgenic lentivirus )

    siRNA is flanked by the XhoI and EcoRI restriction sites.

  • EAP1-3hp siRNA lentivirus ( transgenic lentivirus )

    EAP1-3hp is organized as follows: 5′-XhoI-hairpin I-XbaI-hairpin II- BamHI-hairpin III-EcoRI-3′.

  • GFAP–DN-erbB4/GnRH-GFP transgenic mice ( Mus musculus )

  • HIV-1 lentivirus ( transgenic lentivirus )

    Contains either a transgene (TG) or RNA interference (RNAi) (TG-RNAi) cassette.

  • ICR mice ( Mus musculus )

    WT strain for TrkB transgenic mice.

  • LV-EED ( transgenic lentivirus )

  • LV-EGFP ( transgenic lentivirus )

  • LV-Jagged1-HA ( transgenic lentivirus )

  • LV-sh436 ( transgenic lentivirus )

  • LV-sh436 mism ( transgenic lentivirus )

  • Macaca Mulatta ( Macaca mulatta )

  • Sprague Dawley ( Rattus norvegicus )

  • SynCAM1 (GFAP-DNSynCAM1) mice ( Mus musculus )

    Male heterozygous mice that express an astrocyte-specific dominant-negative form of SynCAM1 (GFAP-DNSynCAM1) under control of the glial fibrillary acidic protein (GFAP) promoter on the FvB/N background were bred to either FvB/N or C57BL/6 J wild-type (WT) females. Three independent transgenic lines of GFAP-DNSynCAM1 mice (Lines 27, 42 and 45) were used to generate offspring.

  • TrkB-/+ ( Mus musculus )

  • TrkB-null ( Mus musculus )

Reagents

  • Cyclophilin antisense probe ( Morpholino )

  • DNMT1 [35]S-uridine 5-triphosphate (UTP)-labeled cRNA probe ( RNA probe )

  • EAP1-C pGL2 ( Plasmid )

    Luciferase reporter plasmid.

  • EAP1-G pGL2 ( Plasmid )

    Luciferase reporter plasmid.

  • EAP1-pPRIME microRNA LV ( Lentiviral plasmid )

  • FLJ22457 [35]S-uridine 5-triphosphate (UTP)-labeled cRNA probes ( RNA probe )

  • Fxna antisense RNA probe ( Morpholino )

  • LV-EED plasmid ( Lentiviral plasmid )

  • LV-EGFP plasmid ( Lentiviral plasmid )

    "The original PGK promoter driving expression of an enhanced green fluorescent protein (EGFP) was replaced by a cytomegalovirus (CMV) promoter."

  • LV-Jagged1-HA plasmid ( Lentiviral plasmid )

    "cDNA containing the rat Jagged1-coding region fused to a sequence encoding a human influenza hemagglutinin (HA) epitope (kindly provided by Gerry Weinmaster; Department of Biological Chemistry, University of California, Los Angeles, CA) was inserted into the multiple cloning site of a LV vector. To restrict Jagged1 expression to oocytes, the cytomegalovirus promoter of this vector was replaced by the Gdf9 promoter (kindly provided by Austin Cooney; Baylor College of Medicine, Hous- ton, TX)."

  • LV-sh436 mism shRNA plasmid ( Lentiviral plasmid )

    "A DNA fragment encoding siRNA 436 with nucleotide mismatches."

  • LV-sh436 shRNA plasmid ( Lentiviral plasmid )

    "The DNA sequence encoding the most potent siRNA (siRNA 436) was cloned into the ApaI-EcoRI sites of the multiple cloning site of the U6 cassette."

  • p53 [35]S-uridine 5-triphosphate (UTP)-labeled cRNA probe ( RNA probe )

  • pcDNA YY1 ( Plasmid )

  • pcDNA-Zeo-Fxna-FLAG plasmid ( Plasmid )

    "A tagged Fxna construct was generated by PCR-amplifying the Fxna coding region from ovarian RNA with a sense primer (5􏰂- GGATCCGCTGCCGCCATGGAGTGG-3􏰂) and an antisense primer (5􏰂- GATATCATATTACTTGTCGTCATCGTCTTTGTAGTCA A ACACA A AGA- GACTATA-3􏰂) that contains a FLAG epitope-coding sequence (in italics); BamH1 and EcoRV sequences added to the sense and antisense primers, respectively, are underlined. The resulting construct was ligated into pcDNA-Zeo (Invitrogen)."

  • pCMV-Tag1-Fxna ( Plasmid )

    "The coding region of Fxna mRNA was cloned using the FailSafe PCR System Kit (Epicentre Biotechnologies, Madison, WI) and primers (forward, 5-TATAGATCTTGGAGTGGAGCTCGGAAGT-3; reverse, 5-TAT- AGATCTTTAAAACACAAAGAGACTATAGGTGG-3), containing a BglII site at their 5􏰂 ends (underlined). The PCR product was cloned into the pGEM-T vector (Promega, Madison, WI) and sequenced from both ends, before cloning into the BglII site of the expression vector pCMV-Tag1 (Stratagene, San Diego, CA)."

  • pCMV-Tag1-Fxna siRNA ( RNA interference plasmid )

    "Expression vector (pCMV-Tag1, Stratagene) encoding Fxna mRNA carrying silent point mutations of the siRNA target region. The third base of each of two codons in this region was mutated (5􏰂-AACAGCCTCCACAGAATaTCt), using the QuickChange XL Site-Directed Mutagenesis Kit (Stratagene)."

  • pGEM-T-Cbx7 ( Plasmid )

  • pGEM-T-Eed ( Plasmid )

  • pGL2-Kiss1 ( Plasmid )

    Luciferase reporter plasmid.

  • Rat Cbx7 cRNA probe ( RNA probe )

  • Rat Eed cRNA probe ( RNA probe )

  • Rat Kiss1 cRNA probe ( RNA probe )

  • SASH1 [35]S-uridine 5-triphosphate (UTP)-labeled cRNA probe ( RNA probe )


Web Links:

Last updated: 2013-06-12T15:13:23.753-05:00

Copyright © 2016 by the President and Fellows of Harvard College
The eagle-i Consortium is supported by NIH Grant #5U24RR029825-02 / Copyright 2016