 |
|  Oregon Health and Science University |
|
| Oregon Health and Science University |
Sergio Ojeda and his collaborators seek to understand the process by which the brain controls the initiation of mammalian puberty. An important goal in their laboratory is to gain insights into the molecular and genetic mechanisms underlying deranged sexual development, particularly sexual precocity and delayed puberty of cerebral origin. Ojeda's team focuses on identifying molecules responsible for the interactions that occur between neurons and glial cells in the hypothalamus, a region in the base of the brain that controls several bodily functions, including hormone secretion, reproduction, response to stress, feeding and sex behavior. One group of hypothalamic neurons produces gonadotropin-releasing hormone (GnRH), a substance that controls the secretion of reproductive hormones from the pituitary gland.
The investigators are using cellular, molecular, genetics and systems biology strategies, in addition to high-throughput approaches and computational biology methods to develop three interrelated concepts: 1) That mammalian puberty is controlled by genetic networks that, operating within different cell contexts in the neuroendocrine brain, coordinate the activity of GnRH neurons at puberty, 2) That these networks are controlled at the transcriptional level by a repressive mechanism exerted by discrete subsets of gene "silencers", and 3) That this transcriptional regulation is under epigenetic control, i.e. a mechanism by which environmental factors (such as nutrition, man-made chemicals, changes in light/dark cycle, etc.) regulate gene activity without modifying the actual sequence of encoding DNA.
siRNA is flanked by the XhoI and EcoRI restriction sites.
EAP1-3hp is organized as follows: 5′-XhoI-hairpin I-XbaI-hairpin II- BamHI-hairpin III-EcoRI-3′.
Contains either a transgene (TG) or RNA interference (RNAi) (TG-RNAi) cassette.
WT strain for TrkB transgenic mice.
Male heterozygous mice that express an astrocyte-specific dominant-negative form of SynCAM1 (GFAP-DNSynCAM1) under control of the glial fibrillary acidic protein (GFAP) promoter on the FvB/N background were bred to either FvB/N or C57BL/6 J wild-type (WT) females. Three independent transgenic lines of GFAP-DNSynCAM1 mice (Lines 27, 42 and 45) were used to generate offspring.
Luciferase reporter plasmid.
Luciferase reporter plasmid.
"The original PGK promoter driving expression of an enhanced green fluorescent protein (EGFP) was replaced by a cytomegalovirus (CMV) promoter."
"cDNA containing the rat Jagged1-coding region fused to a sequence encoding a human influenza hemagglutinin (HA) epitope (kindly provided by Gerry Weinmaster; Department of Biological Chemistry, University of California, Los Angeles, CA) was inserted into the multiple cloning site of a LV vector. To restrict Jagged1 expression to oocytes, the cytomegalovirus promoter of this vector was replaced by the Gdf9 promoter (kindly provided by Austin Cooney; Baylor College of Medicine, Hous- ton, TX)."
"A DNA fragment encoding siRNA 436 with nucleotide mismatches."
"The DNA sequence encoding the most potent siRNA (siRNA 436) was cloned into the ApaI-EcoRI sites of the multiple cloning site of the U6 cassette."
"A tagged Fxna construct was generated by PCR-amplifying the Fxna coding region from ovarian RNA with a sense primer (5- GGATCCGCTGCCGCCATGGAGTGG-3) and an antisense primer (5- GATATCATATTACTTGTCGTCATCGTCTTTGTAGTCA A ACACA A AGA- GACTATA-3) that contains a FLAG epitope-coding sequence (in italics); BamH1 and EcoRV sequences added to the sense and antisense primers, respectively, are underlined. The resulting construct was ligated into pcDNA-Zeo (Invitrogen)."
"The coding region of Fxna mRNA was cloned using the FailSafe PCR System Kit (Epicentre Biotechnologies, Madison, WI) and primers (forward, 5-TATAGATCTTGGAGTGGAGCTCGGAAGT-3; reverse, 5-TAT- AGATCTTTAAAACACAAAGAGACTATAGGTGG-3), containing a BglII site at their 5 ends (underlined). The PCR product was cloned into the pGEM-T vector (Promega, Madison, WI) and sequenced from both ends, before cloning into the BglII site of the expression vector pCMV-Tag1 (Stratagene, San Diego, CA)."
"Expression vector (pCMV-Tag1, Stratagene) encoding Fxna mRNA carrying silent point mutations of the siRNA target region. The third base of each of two codons in this region was mutated (5-AACAGCCTCCACAGAATaTCt), using the QuickChange XL Site-Directed Mutagenesis Kit (Stratagene)."
Luciferase reporter plasmid.
